Nuclear RNA export factor 1

Protein information

  • Protein ID: Q9UBU9
  • Protein Name : Nuclear RNA export factor 1
  • Gene : NXF1
  • Organism : Homo sapiens
  • Status : reviewed
  • Function : Involved in the nuclear export of mRNA species bearing retroviral constitutive transport elements (CTE) and in the export of mRNA from the nucleus to the cytoplasm (TAP/NFX1 pathway) (PubMed:10924507). The NXF1-NXT1 heterodimer is involved in the export of HSP70 mRNA in conjunction with ALYREF/THOC4 and THOC5 components of the TREX complex (PubMed:18364396 PubMed:19165146 PubMed:9660949). ALYREF/THOC4-bound mRNA is thought to be transferred to the NXF1-NXT1 heterodimer for export (PubMed:18364396 PubMed:19165146 PubMed:9660949). Also involved in nuclear export of m6A-containing mRNAs: interaction between SRSF3 and YTHDC1 facilitates m6A-containing mRNA-binding to both SRSF3 and NXF1 promoting mRNA nuclear export (PubMed:28984244).

Protein Sequence

  • MADEGKSYSEHDDERVNFPQRKKKGRGPFRWKYGEGNRRSGRGGSGIRSSRLEEDDGDVAMSDAQDGPRVRYNPYTTRPNRRGDTWHDRDRIHVTVRRDRAPPERGGAGTSQDGTSKNWFKITIPYGRKYDKAWLLSMIQSKCSVPFTPIEFHYENTRAQFFVEDASTASALKAVNYKILDRENRRISIIINSSAPPHTILNELKPEQVEQLKLIMSKRYDGSQQALDLKGLRSDPDLVAQNIDVVLNRRSCMAATLRIIEENIPELLSLNLSNNRLYRLDDMSSIVQKAPNLKILNLSGNELKSERELDKIKGLKLEELWLDGNSLCDTFRDQSTYISAIRERFPKLLRLDGHELPPPIAFDVEAPTTLPPCKGSYFGTENLKSLVLHFLQQYYAIYDSGDRQGLLDAYHDGACCSLSIPFIPQNPARSSLAEYFKDSRNVKKLKDPTLRFRLLKHTRLNVVAFLNELPKTQHDVNSFVVDISAQTSTLLCFSVNGVFKEVDGKSRDSLRAFTRTFIAVPASNSGLCIVNDELFVRNASSEEIQRAFAMPAPTPSSSPVPTLSPEQQEMLQAFSTQSGMNLEWSQKCLQDNNWDYTRSAQAFTHLKAKGEIPEVAFMK

RRM domains in this Protein - 1 

RRM Entryname RRM Sequence range Pfam ID
Q9UBU9_RRM1 119 - 198 PF09162

Experiments retrieved for this Protein - 6 

Experiment ID Experiment Type PubMed ID
Exp_1FO1 X-ray Diffraction 11060011
Exp_1FT8 X-ray Diffraction 11060011
Exp_1KOH X-ray Diffraction 11854490
Exp_1KOO X-ray Diffraction 11854490
Exp_3RW6 X-ray Diffraction 21822283
Exp_3RW7 X-ray Diffraction 21822283

Ligands tested for Binding - 1 

Ligand ID Ligand Type Ligand Sequence
Lig214 RNA GGCACUAACCUAAGACAGGAGGGCCGGGAAACCUGCCUAAUCCAAUGACGGGUAAUAGUGUC