Poly(U)-binding-splicing factor PUF60

Protein information

  • Protein ID: Q9UHX1
  • Protein Name : Poly(U)-binding-splicing factor PUF60
  • Gene : PUF60
  • Organism : Homo sapiens
  • Status : reviewed
  • Function : DNA- and RNA-binding protein involved in several nuclear processes such as pre-mRNA splicing apoptosis and transcription regulation. In association with FUBP1 regulates MYC transcription at the P2 promoter through the core-TFIIH basal transcription factor. Acts as a transcriptional repressor through the core-TFIIH basal transcription factor. Represses FUBP1-induced transcriptional activation but not basal transcription. Decreases ERCC3 helicase activity. Does not repress TFIIH-mediated transcription in xeroderma pigmentosum complementation group B (XPB) cells. Is also involved in pre-mRNA splicing. Promotes splicing of an intron with weak 3'-splice site and pyrimidine tract in a cooperative manner with U2AF2. Involved in apoptosis induction when overexpressed in HeLa cells. Isoform 6 failed to repress MYC transcription and inhibited FIR-induced apoptosis in colorectal cancer. Isoform 6 may contribute to tumor progression by enabling increased MYC expression and greater resistance to apoptosis in tumors than in normal cells. Modulates alternative splicing of several mRNAs. Binds to relaxed DNA of active promoter regions. Binds to the pyrimidine tract and 3'-splice site regions of pre-mRNA; binding is enhanced in presence of U2AF2. Binds to Y5 RNA in association with RO60. Binds to poly(U) RNA.

Protein Sequence

  • MATATIALQVNGQQGGGSEPAAAAAVVAAGDKWKPPQGTDSIKMENGQSTAAKLGLPPLTPEQQEALQKAKKYAMEQSIKSVLVKQTIAHQQQQLTNLQMAAVTMGFGDPLSPLQSMAAQRQRALAIMCRVYVGSIYYELGEDTIRQAFAPFGPIKSIDMSWDSVTMKHKGFAFVEYEVPEAAQLALEQMNSVMLGGRNIKVGRPSNIGQAQPIIDQLAEEARAFNRIYVASVHQDLSDDDIKSVFEAFGKIKSCTLARDPTTGKHKGYGFIEYEKAQSSQDAVSSMNLFDLGGQYLRVGKAVTPPMPLLTPATPGGLPPAAAVAAAAATAKITAQEAVAGAAVLGTLGTPGLVSPALTLAQPLGTLPQAVMAAQAPGVITGVTPARPPIPVTIPSVGVVNPILASPPTLGLLEPKKEKEEEELFPESERPEMLSEQEHMSISGSSARHMVMQKLLRKQESTVMVLRNMVDPKDIDDDLEGEVTEECGKFGAVNRVIIYQEKQGEEEDAEIIVKIFVEFSIASETHKAIQALNGRWFAGRKVVAEVYDQERFDNSDLSA

RRM domains in this Protein - 2 

RRM Entryname RRM Sequence range Pfam ID
Q9UHX1_RRM1 131 - 201 PF00076
Q9UHX1_RRM2 228 - 298 PF00076

RRM domain Linkers in this Protein - 1 

Linker Name Linker Sequence range
Q9UHX1_linker1 202 - 227

Experiments retrieved for this Protein - 8 

Experiment ID Experiment Type PubMed ID
Exp_2KXF NMR 20711187
Exp_2KXH NMR 20711187
Exp_2QFJ X-ray Diffraction 18059478
Exp_3UWT X-ray Diffraction
Exp_5KVY X-ray Diffraction 33253191
Exp_5KW1 X-ray Diffraction 33253191
Exp_5KW6 X-ray Diffraction 33253191
Exp_5KWQ X-ray Diffraction 33253191

Ligands tested for Binding - 2 

Ligand ID Ligand Type Ligand Sequence
Lig174 DNA TCGGGATTTTTTATTTTGTGTTATT
Lig87 RNA GAUGUCAUACUUAUCCUGUCCCUUUUUUUU