U1 small nuclear ribonucleoprotein A
-
Protein ID: Q06AA4
- Protein Name : U1 small nuclear ribonucleoprotein A
- Gene : SNRPA
- Organism : Sus scrofa
- Status : reviewed
- Function : Component of the spliceosomal U1 snRNP which is essential for recognition of the pre-mRNA 5' splice-site and the subsequent assembly of the spliceosome. U1 snRNP is the first snRNP to interact with pre-mRNA. This interaction is required for the subsequent binding of U2 snRNP and the U4/U6/U5 tri-snRNP. SNRPA binds stem loop II of U1 snRNA. In a snRNP-free form (SF-A) may be involved in coupled pre-mRNA splicing and polyadenylation process. May bind preferentially to the 5'-UGCAC-3' motif on RNAs (By similarity).
- MAVPETRPNHTIYINNLNEKIKKDELKKSLYAIFSQFGQILDILVSRSLKMRGQAFVIFKEVSSATNALRSMQGFPFYDKPMRIQYAKTDSDIIAKMKGTFVERDRKREKRKPKSQETPASKKAVQGGAAAPVVGAVQGPVPGMPPMTQTPRIMHHMPGQPPYMPPPGMIPPPGLAPGQIPPGAMPPQQLMPGQMPPAQPLSENPPNHILFLTNLPEETNELMLSMLFNQFPGFKEVRLVPGRHDIAFVEFDNEVQAGAARDALQGFKITQNNAMKISFAKK
Experiment ID |
Experiment Type |
PubMed ID |
Exp_4PKD |
X-ray Diffraction |
25555158
|
Ligand ID |
Ligand Type |
Ligand Sequence |
Lig179 |
RNA |
GGAUCCAUUGCACUCCGGAUCCAGGAGAUACCAUGAUCACGAAGGUGGUUUUCCU |