U1 small nuclear ribonucleoprotein A

Protein information

  • Protein ID: Q06AA4
  • Protein Name : U1 small nuclear ribonucleoprotein A
  • Gene : SNRPA
  • Organism : Sus scrofa
  • Status : reviewed
  • Function : Component of the spliceosomal U1 snRNP which is essential for recognition of the pre-mRNA 5' splice-site and the subsequent assembly of the spliceosome. U1 snRNP is the first snRNP to interact with pre-mRNA. This interaction is required for the subsequent binding of U2 snRNP and the U4/U6/U5 tri-snRNP. SNRPA binds stem loop II of U1 snRNA. In a snRNP-free form (SF-A) may be involved in coupled pre-mRNA splicing and polyadenylation process. May bind preferentially to the 5'-UGCAC-3' motif on RNAs (By similarity).

Protein Sequence

  • MAVPETRPNHTIYINNLNEKIKKDELKKSLYAIFSQFGQILDILVSRSLKMRGQAFVIFKEVSSATNALRSMQGFPFYDKPMRIQYAKTDSDIIAKMKGTFVERDRKREKRKPKSQETPASKKAVQGGAAAPVVGAVQGPVPGMPPMTQTPRIMHHMPGQPPYMPPPGMIPPPGLAPGQIPPGAMPPQQLMPGQMPPAQPLSENPPNHILFLTNLPEETNELMLSMLFNQFPGFKEVRLVPGRHDIAFVEFDNEVQAGAARDALQGFKITQNNAMKISFAKK

RRM domains in this Protein - 2 

RRM Entryname RRM Sequence range Pfam ID
Q06AA4_RRM1 12 - 83 PF00076
Q06AA4_RRM2 210 - 275 PF00076

RRM domain Linkers in this Protein - 1 

Linker Name Linker Sequence range
Q06AA4_linker1 84 - 209

Experiments retrieved for this Protein - 1 

Experiment ID Experiment Type PubMed ID
Exp_4PKD X-ray Diffraction 25555158

Ligands tested for Binding - 1 

Ligand ID Ligand Type Ligand Sequence
Lig179 RNA GGAUCCAUUGCACUCCGGAUCCAGGAGAUACCAUGAUCACGAAGGUGGUUUUCCU