La-related protein 7

Protein information

  • Protein ID: Q4G0J3
  • Protein Name : La-related protein 7
  • Gene : LARP7
  • Organism : Homo sapiens
  • Status : reviewed
  • Function : RNA-binding protein that specifically binds distinct small nuclear RNA (snRNAs) and regulates their processing and function (PubMed:18249148 PubMed:32017898). Specifically binds the 7SK snRNA (7SK RNA) and acts as a core component of the 7SK ribonucleoprotein (RNP) complex thereby acting as a negative regulator of transcription elongation by RNA polymerase II (PubMed:18249148 PubMed:18483487). The 7SK RNP complex sequesters the positive transcription elongation factor b (P-TEFb) in a large inactive 7SK RNP complex preventing RNA polymerase II phosphorylation and subsequent transcriptional elongation (PubMed:18249148 PubMed:18483487). The 7SK RNP complex also promotes snRNA gene transcription by RNA polymerase II via interaction with the little elongation complex (LEC) (PubMed:28254838). LARP7 specifically binds to the highly conserved 3'-terminal U-rich stretch of 7SK RNA; on stimulation remains associated with 7SK RNA whereas P-TEFb is released from the complex (PubMed:18483487 PubMed:18281698). LARP7 also acts as a regulator of mRNA splicing fidelity by promoting U6 snRNA processing (PubMed:32017898). Specifically binds U6 snRNAs and associates with a subset of box C/D RNP complexes: promotes U6 snRNA 2'-O-methylation by facilitating U6 snRNA loading into box C/D RNP complexes (PubMed:32017898). U6 snRNA 2'-O-methylation is required for mRNA splicing fidelity (PubMed:32017898). Binds U6 snRNAs with a 5'-CAGGG-3' sequence motif (PubMed:32017898). U6 snRNA processing is required for spermatogenesis (By similarity).

Protein Sequence

  • METESGNQEKVMEEESTEKKKEVEKKKRSRVKQVLADIAKQVDFWFGDANLHKDRFLREQIEKSRDGYVDISLLVSFNKMKKLTTDGKLIARALRSSAVVELDLEGTRIRRKKPLGERPKDEDERTVYVELLPKNVNHSWIERVFGKCGNVVYISIPHYKSTGDPKGFAFVEFETKEQAAKAIEFLNNPPEEAPRKPGIFPKTVKNKPIPALRVVEEKKKKKKKKGRMKKEDNIQAKEENMDTSNTSISKMKRSRPTSEGSDIESTEPQKQCSKKKKKRDRVEASSLPEVRTGKRKRSSSEDAESLAPRSKVKKIIQKDIIKEASEASKENRDIEISTEEEKDTGDLKDSSLLKTKRKHKKKHKERHKMGEEVIPLRVLSKSEWMDLKKEYLALQKASMASLKKTISQIKSESEMETDSGVPQNTGMKNEKTANREECRTQEKVNATGPQFVSGVIVKIISTEPLPGRKQVRDTLAAISEVLYVDLLEGDTECHARFKTPEDAQAVINAYTEINKKHCWKLEILSGDHEQRYWQKILVDRQAKLNQPREKKRGTEKLITKAEKIRLAKTQQASKHIRFSEYD

RRM domains in this Protein - 2 

RRM Entryname RRM Sequence range Pfam ID
Q4G0J3_RRM1 127 - 190 PF00076
Q4G0J3_RRM2 454 - 552 PF08777

RRM domain Linkers in this Protein - 1 

Linker Name Linker Sequence range
Q4G0J3_linker1 191 - 453

Experiments retrieved for this Protein - 3 

Experiment ID Experiment Type PubMed ID
Exp_4WKR X-ray Diffraction 25753663
Exp_5KNW NMR 27679474
Exp_6D12 X-ray Diffraction 29946027

Ligands tested for Binding - 2 

Ligand ID Ligand Type Ligand Sequence
Lig70 RNA GGCGCUGCAUGUGGCAGUCUGCCUUUCUUUU
Lig184 RNA GGGCUGCAUGUGGCAGCUCGGGCUGCAUGUGGCAGCUC