Exp_6LAS
Experiment information
Protein involved in this Experiment
| UniProt ID | Protein Length | Mutated Instance |
|---|---|---|
| P09012 | 282 |
RRM domains involved in this Experiment
| RRM Entryname | Sequence Range | RRM Structurename |
|---|---|---|
| P09012_RRM1 | 12 - 83 | 6LASC01, 6LASD01, 6LASE01 |
Binding Information from Structures
Ligands tested for Binding - 1
| Ligand ID | Ligand Type | Ligand Sequence |
|---|---|---|
| Lig45 | RNA | GGCAUUGUGCCUCGCAUUGCACUCCGCGGGGCGAUAAGUCCUGAAAAGGGAUGUC |